Convert DNA sequence to sequence of amino acids

Enter DNA sequence: maximum 60 characters

---

• Enter a DNA sequence into the text box such as "TACCTCGGTCATCCCTACATC".
• Click on the button "Create Amino Acid sequence".
• The complementary DNA strand, mRNA sequence and the sequence of amino acids will be created.

The DNA sequence does not have to start with a TAC start codon.
The amino acid sequence will not stop at a stop codon but will be indicated in the amino acid sequence.